SGN Marker T1023

SGN-M1710
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 3.16
Tomato EST read: TRXBQ81TH
Arabidopsis best BAC match: AF001308.1
Arabidopsis position: 4.0130000
Arabidopsis identities: 0.641
Best GenBank protein hit: AAC78698.1
Evalue: 1.6e-82
Identities: 0.721
Description: PROLIFERA [Arabidopsis thaliana]
Comment: PROLIFERA (PRL) encodes a homologue of the DNA replication licensing factor Mcm7 conserved protein found in all eukaryotes
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39464)
Chromosome
1
Position
46.90 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1023 was used as an overgo probe on plate 8 [well G8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAGCTCGAAGACTTAGCTGACTAC
B sequence
CCTCATCCAAGTCCTTGTAGTCAG
AB sequence
GAGCTCGAAGACTTAGCTGACTACAAGGAC
Marker sequence
GCACAAACTTCCTCTCGATTCTCTCTGCTTCCATTCAAACACCATGAATG
ATCTTGACTTCAACCGCGACAAAGATCTAGCGAAAGATTTTCTGTCAAAC
TTCGCTGATTCTAATGGTGAAGCCAAATACATGAACATTCTCCAAGATGT
TGCTAATCGTAAAACCAAGGCTATTGAGATTGAGCTCGAAGACTTAGCTG
ACTACAAGGACTTGGATGAGGAGTTTCTTCGAAGAATTGCTGAGAACACT
AAACGATATATCACAATATTAGCAAGTGCGATTGATGAGCTCATGCCAGA
GCCAACGGAGGCTTTTCCAGATGATGATCATGATATTTTGATGACTCAGC
GGTCAGAGGAAGTAACTGAGAACACTGATGGTTCTGATCCAAAACAAAAG
ATGCCCCCAGAGATCAAGCGGTTCTATGAAGTGTATGTTAAAGCATCTTC
AAAAGGTCGGCCCTTTACAATTAGGGAGGTCAAGGCTTCGTACATTGGTC
AGCTTGTCAGGATATCTGGTATTGTGACACGTTGTTCGGATGTTAAGCCA
CTGATGCAGGTGGCTGTATATACATGTGAAGAATGTGGATTTGAAATTTA
TCAGGAAGTAACTGCTAGAGTATTCATGCCTCTGTCTGAATGCCCAT
Genomic location of T1023  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1710 marker 1710
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)