SGN Marker T1047

SGN-M1723
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 10.01.01.05
Tomato EST read: TFBAA12THB
Arabidopsis best BAC match: AB019232.1
Arabidopsis position: 3.0620000
Arabidopsis identities: 0.720
Best GenBank protein hit: BAB00001.1
Evalue: 2.4e-51
Identities: 0.664
Description: AHP1 (His-Asp Phosphotransfer Signal Transducers) [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39470)
Chromosome
8
Position
20.00 cM
Confidence
CF(LOD3)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39471)
Chromosome
1
Position
105.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1047 was used as an overgo probe on plate 3 [well E1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCAGCTGAAAGGTAGCAGCTCTAG
B sequence
TCTTTGTGCCCCAATGCTAGAGCT
AB sequence
TCAGCTGAAAGGTAGCAGCTCTAGCATTGG
Marker sequence
TTTACTCCATGCACAAATAAGGAGTATATATAACTTCTCAATTTTCATTA
ATAGCATAGCAAGCTGTTAATTTGTGAAAGTCACTCTTGAATTTAGCAAA
ATCATGGAACAAATCCAAAGAAAACTAGCTGAGTACACTGCTTCCTTGTA
CAATGAGAAAATTCTGGATGAACAGTTTATACAACTTCAGCAACTGCAAG
ATGAGAGCAATCCTGATTTTGTGGTGGAAGTTGTATCCCTTTTCTTTGAA
GATTCTGAAAGGCTTCTTAATGAACTTGCAAAAGCTCTCAATCAGTCTAA
TGTAGACTTCAAGAAACTGGATGCTCATGTTCATCAGCTGAAAGGTAGCA
GCTCTAGCATTGGGGCACAAAGAGTTCAAAGAGTGTGCATTTCCTTCCGT
AATTATTGTGATGAACGCAATGTTGAAGGGTGCTTAAAATGTTTGCAACA
AGTGAAAATTGAGTACACCCTTGTCAAGAACAAGCTTGAAACTTTATTTA
AGCTGGAGAAACAATTCGTGGATGCCGGAGGATCATTTCCAGTGGTGTGA
ATATTGATTGATGAGATATATGGAAATTAATTATGTTTAATTAATGGCAA
CTTTAATTAGAAGTTATTTGGATATGTTAAATT
Genomic location of T1047  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1723 marker 1723
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)