SGN Marker T1062

SGN-M1733
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBAA80THB
Arabidopsis best BAC match: AC008113.4
Arabidopsis position: 1.1330000
Arabidopsis identities: 0.816
Best GenBank protein hit: BAB00011.1
Evalue: 1.4e-53
Identities: 0.793
Description: similar to unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39478)
Chromosome
10
Position
3.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1062 was used as an overgo probe on plate 15 [well C11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCATCCTGTTGCCAATGTTAGACC
B sequence
AAGCGAATCTCGCAGAGGTCTAAC
AB sequence
GCATCCTGTTGCCAATGTTAGACCTCTGCG
Marker sequence
CGACGCCTTCGCCGTCCACAAAACCTAATCACAGGCAACCGGAAAAATAA
ATCACAGAATACTCCTATCGACGACGACTACGCCGGTGGACGGCGGCGGC
GGAGAAGTACCTTCATCGTATAGATCCACCAATCAAAGCCTCATCGGCGC
CAATTGGAAGAAAACTAGTCTAGATTCTATAAGTTTCCGGTAGATTATCA
AATCTCCGTCCGTTTGGTTTTCTATATCTCAATTATCTTACCAGATGAAC
GAAGTGCTTACAGCTTCCGATGCATCTTCAAGTGCGCGGTCGTATTCGTC
GTCGATTGCACCTGTCAATGTTCCCCTCTTTTCGGCATTACTTGCCTGTG
CTATTGCACAATTTCTCAAGCTATTCACCACCTGGTACAAGGAGAAGAGA
TGGGATTCAAAAAGGATGCTTAGCTCAGGTGGAATGCCATCATCACATTC
AGCAACAGTTACTTCACTGATAATGGCAATTTATTTACAGGAAGGAGCTG
GAGGATCTGTCTTCGCGATTGCTGTGGTTTTGGCATGTGTTGTAATGTAT
GATGCTACTGGTGTTAGGCTTCATGCTGGGCGCCAGGCTGAATTGTTGAA
CCAGATAGTGTGTGAATTGCCTCCCGAGCATCCTGTTGCCAATGTTAGAC
CTCTGCGAGATTCGCTTGGTCACACTCCCCTTCAGGTTCTTGCCGGTGCA
GTGCTGGGATGTGTAGTGCCATTACTGCTGAGAAGCTCAATCTAGAGTTC
AACTNTATGATCTCCCTTCAAATACTCAGTAAATATCCGAATGGTTCTAA
GCTATTAAAGCTGGAATCAACATC
Genomic location of T1062  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1733 marker 1733
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)