SGN Marker T1064

SGN-M1735
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 4.05.01.04
Tomato EST read: TFBAN25TH
Arabidopsis best BAC match: AB016880.1
Arabidopsis position: 5.2690000
Arabidopsis identities: 0.915
Best GenBank protein hit: BAB10162.1
Evalue: 2.8e-75
Identities: 0.930
Description: auxin response factor-like protein [Arabidopsis
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39480)
Chromosome
3
Position
138.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1064 was used as an overgo probe on plate 2 [well F4]

Plausible BAC Matches:   P167L01,   P278E15,   P012A08,   P047K14,   P286H05,   P113E22,   P260L05,   P226M05,   P143B18,   P115C02,   P189E21,   P106G05,   P204B18,   P311A23,   P300K06,   P302P09,   P033A22

 Overgo Sequences

A sequence
TTGGTGTTAGACGTGCCATGAGAC
B sequence
GGAGCATTTCCTTGCTGTCTCATG
AB sequence
TTGGTGTTAGACGTGCCATGAGACAGCAAG
Marker sequence
GCTGGACATGTCTCGGCAGCCTCCCACACAAGAGTTGGTGGCCAAAGATT
TACATGGAAATGAGTGGCGATTCAAGCATATATTCCGGGGCCAGCCTAGG
AGGCATCTTCTTCAGAGTGGTTGGAGTGTCTTTGTTAATTCTAAGAGGCT
TGTTGCTGGGGATGCATTCATATTTCTTAAAGGTGAGAATGGGGAGCTTC
GTGTTGGTGTTAGACGTGCCATGAGACAGCAAGGAAATGCTCCATCATCG
GTGATATCCAGTCATAGCATGCATCTTGGTGTACTTGCAACAGCTTGGCA
TGCCATTCAAACAAAAACGATGTTCACTGTGTATTACAAGCCCAGGACAA
GCCCTGCTGAGTTTATAGTTCCATATGACCACTATATGGAATCTGTGAAG
AATAATTACTCTATTGGAATGAGGTTTAAGATGA
Genomic location of T1064  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1735 marker 1735
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)