SGN Marker T1068

SGN-M1739
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.03.07
Tomato EST read: TFBAN45TH
Arabidopsis best BAC match: AC007019.4
Arabidopsis position: 2.1250000
Arabidopsis identities: 0.960
Best GenBank protein hit: CAA71816.1
Evalue: 1e-108
Identities: 0.964
Description: ribonucleotide reductase [Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49384)
Chromosome
4
Position
4.39 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47319)
Chromosome
4
Position
26.35 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39483)
Chromosome
4
Position
33.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1068 was used as an overgo probe on plate 6 [well H12]

Plausible BAC Matches:   P022O07,   P109E20,   P028M19,   P074K04,   P024G05,   P070F01,   P152M22,   P021F09,   P265K12,   P265B08,   P128G06,   P028L04,   P007F03,   P076N16,   P126O21,   P118P05,   P173E01,   P265M08,   P211J17,   P076P14,   P247H24,   P304L01,   P082L13,   P010G02

 Overgo Sequences

A sequence
ACACAAGTCCTACTGAAACTGCTG
B sequence
GAGGCAAGATTGCACACAGCAGTT
AB sequence
ACACAAGTCCTACTGAAACTGCTGTGTGCA
Marker sequence
ATGGAGAGAGTCCAAAGCAATGGGCAATGGTCTTTATTTTGTCCAAGTGA
GGCTCCTGGATTGGCAGATTGCTGGGGTGATGATTTTGAGAAGCTGTATT
CGAAGTATGAAAGAGAGGGTAAGGCTAAGAAGGTTGTGCAAGCACAAAAT
CTCTGGTTTGAGATCTTGAAGTCTCAGATAGAAACTGGGACCCCATACAT
GCTATATAAGGATACTTGTAACAGAAAAAGCAACCAGCAGAATCTTGGCA
CAATCAAGTCTTCTAACTTGTGTACTGAAATTATTGAATACACAAGTCCT
ACTGAAACTGCTGTGTGCAATCTTGCCTCAATTGCTCTTCCACGATATGT
TAGAGAGAAGGAGGTTCCTAGTGAATCACAACCATCTAAGCTTGTTGGGA
GCAGAGGCGCTAAAAACCGGTACTTTGATTTTGACAAACTGGCAGAGGTC
ACTGCATTGGTGACTACAAACCTGAACAAAATTATTGATGTCAACTACTA
CCCTGTTGAAACTGCAAAAAGGTCTAATTTACGACATAGACCTATTGGAC
TTGGGGTCCAAAGTCTTGCAGATACATTCATATTGCTTGGCATG
Genomic location of T1068  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1739 marker 1739
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)