SGN Marker T1070

SGN-M1740
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.13.01
Tomato EST read: TFBAN53TH
Arabidopsis best BAC match: AC013483.5
Arabidopsis position: 3.0121000
Arabidopsis identities: 0.888
Best GenBank protein hit: AAF21209.1
Evalue: 5.2e-31
Identities: 0.867
Description: putative serine carboxypeptidase II [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39484)
Chromosome
4
Position
53.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1070 was used as an overgo probe on plate 8 [well H9]

Plausible BAC Matches:   P032O20,   P203L19,   P270M07,   P137G10

 Overgo Sequences

A sequence
TGCATTGAAGCTCCCAACTATCAC
B sequence
CCAAGGGTACCAGTTTGTGATAGT
AB sequence
TGCATTGAAGCTCCCAACTATCACAAACTG
Marker sequence
CTCGATATTCTATAGATGCATTGAAGCTCCCAACTATCACAAACTGGTAC
CCTTGGTATGACAATAAAAAGGTTGGAGGATGGAGCCAAATATACAAAGG
GTTAACCCTTGTAACTATAACAAGAGCAGGGCATGAAGTTCCTCTTCATC
GCCCTCGTCAAGCTTTCATTCTATTCAGATCATTTTTGGAGAACAAGCCC
ATGCCAAGCTAAACAAAGTCAATCTGTAGAGAATCTTCGATTGATCATGT
TGTCAAAGGACCAGAGATAACGATATAATCCCTCATTTCTTTCCCCTCGA
CTGGTATATCAGTAAAGGCCGCGGGGGAGATTCAAGATTATTACTTACAC
CTCAATAATGCTATACAATGGCTACATTAGAATTTCCATTCATATATTAG
TTTGACTTCATTTGTAGATAAAAGCATTCCATGTAAATGGAGTTTCCAGT
TGAAGACATTCTTATTATAGGAAAATCCTACTTGTTTGGAGACAAATTTG
ACTCCTTGCAACTATAGCTTTT
Genomic location of T1070  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1740 marker 1740
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)