SGN Marker T1071

SGN-M1741
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.13.04
Tomato EST read: TFBAN60TH
Arabidopsis best BAC match: AB005243.1
Arabidopsis position: 5.0350000
Arabidopsis identities: 0.586
Best GenBank protein hit: BAB10607.1
Evalue: 1.9e-40
Identities: 0.598
Description: prolylcarboxypeptidase-like protein [Arabidopsis
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49385)
Chromosome
11
Position
49.45 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47320)
Chromosome
11
Position
77.55 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39485)
Chromosome
11
Position
63.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1071 was used as an overgo probe on plate 3 [well C5]

Plausible BAC Matches:   P327I19,   P136P04

 Overgo Sequences

A sequence
GAGACCCTCTTGGTATTGGATTTC
B sequence
GGTGCAAAATCAGTGAGAAATCCA
AB sequence
GAGACCCTCTTGGTATTGGATTTCTCACTG
Marker sequence
AAGATGAATAAACTTTTCTTATTCCAATGGCTTCTTTTATTGATCTTCAC
AAAAACATCATTAATTTCTTCAAAACCCCATAAAATCCCAAGACTAACAC
CACTTATTGAAAATATAATTCAAGATCATTCTAATACCTTTTCTTCTTCA
TCAAGAAATGATCTTCCAAAAGAATTTGAGACTTACTATTATAAACAAAC
ACTCGATCATTTTAATTATGGACCAAAAAGTTATTCAACTTTTAAACAAA
GGTATATAATTAATTCTAAGTATTGGGGTGGTTCCAATTCAAATTCTCCA
ATTTTTGCCTATCTTGGTGCTGAATCTTCTATTGATAGAGACCCTCTTGG
TATTGGATTTCTCACTGATTTTGCACCTCAATTTAAGGCTCTTCTTGTTT
ACATGGAGCATAGATATTATGGAGAATCAATACCATTTAAGACAATGGAA
GAAGCTTTAAAAGATGAAGATAGTNGAGGATATTTCAATTCAACACAAGC
TATAGCTGATTATGCAGAACTTTTGTTACATATTAAACAAAAATATTCAG
C
Genomic location of T1071  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1741 marker 1741
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)