SGN Marker T1072

SGN-M1742
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TFBAN61TH
Arabidopsis best BAC match: AL133363.1
Arabidopsis position: 3.1149000
Arabidopsis identities: 0.489
Best GenBank protein hit: CAB62473.1
Evalue: 6.1e-50
Identities: 0.500
Description: putative protein [Arabidopsis thaliana]
Comment: 2nd match e-39 with polyneuridine aldehyde esterase [Rauvolfia serpentina] AAF22288
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39486)
Chromosome
1
Position
14.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1072 was used as an overgo probe on plate 3 [well B5]

Plausible BAC Matches:   P323B04,   P076C17,   P288M13,   P273H18,   P288M14,   P056M19,   P306D03,   P111N18,   P093A11,   P262M18,   P222D12,   P162K04,   P147A24,   P272C02,   P125O10,   P111M19,   P217P24,   P013M07,   P162G22,   P327C24

 Overgo Sequences

A sequence
CCACCAACAAGTGCTATTTTTGGC
B sequence
CTTGCATGTACTGTGGGCCAAAAA
AB sequence
CCACCAACAAGTGCTATTTTTGGCCCACAG
Marker sequence
GCTTTTAAGTAGCATTTATCTACACAATAATAATATGGAGAAAATTGGAG
GAATTAAAAGTTTTAACATGGAGAAAATTCCAAAGAAGCATTTTATCCTA
GTTCATGGATTTTGTCATGGTTCTTGGTGTTGGTACAAAATTATCAATTT
ATTGGAAAAATGTGGTCATAAAGTGACTGCTTTAGACCTTGGTGGTTGTG
GAATTAATATGAAACAATTGAATGAAATTGATTCAATATTTGATTATATT
CAACCTTTGATGGATCTTATGATATCTTTGTCTAAAGATGAAAAGATTAT
TTTGGTTAGTCATAGTTACGGTGGTCTTTGTATTTCTCTTGCTATGGAAG
CTTTCCCACACAAAATTTCAACAGGAGTGTTTATCTCTGCTTATATGCCT
AATCATGTGGATCCACCTTCTCTTCTTATTCTTGAGTACTTCAAGAGGAC
TTCAGTGGAGTCACTTATGGATTGCCAATTTAAGTTTGATCAAGGCATGG
AAAATCCACCAACAAGTGCTATTTTTGGCCCACAGTACATGCAAGCTAAT
CTTTACAAGAATTGCC
Genomic location of T1072  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1742 marker 1742
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)