SGN Marker T1074

SGN-M1744
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.13.01
Tomato EST read: TFBAN69TH
Arabidopsis best BAC match: AC021043.4
Arabidopsis position: 1.0616000
Arabidopsis identities: 0.857
Best GenBank protein hit: AAF88122.1
Evalue: 4.6e-74
Identities: 0.855
Description: Similar to 26S proteasome subunits [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39487)
Chromosome
5
Position
61.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1074 was used as an overgo probe on plate 1 [well B4]

Plausible BAC Matches:   P160F21,   P281J06,   P015O20

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GGAATTGTTGATGCGGTGGCTAAG
B sequence
CAGATGTACCCGGTATCTTAGCCA
AB sequence
GGAATTGTTGATGCGGTGGCTAAGATACCG
Marker sequence
CAAAATTGTTAATAAAGGAATTGTTGATGCGGTGGCTAAGATACCGGGTA
CATCTGACCTTCAGATTACACTTTGCAAAGATATAGTGCAGTGGGCCCGT
TCGGAGAAACGAACTTTCCTTCGTCAGCGGGTTGAGGCAAAACTTGCAGC
TCTTTTGATGGAAAACAAAGAGTATTCTGAAGCATTGACACTCCTTTCAG
GGTTGATCAAGGAGGTGAGAAGATTGGATGACAAGCTTCTTCTTGTGGAG
ATTGACTTGCTGGAGAGCCAGCTCCATTTCTCATTGAGAAATCTTCCCAA
AGCCAAGGCTGCACTTACTGCTGCTCGAACAGCTGCCAATGCTATTTATG
TCCCTCCAGCTCAGCAAGGTGCGATTGATTTGCAGAGTGGGATACTCCAT
GCAGAAGAGAAGGATTATAAAACTGCTTACAGCTATTTCTATGAGGCATT
TGAAGCATTTAATGCCCTTGAAAATCCCCAGGCCCTATACAGCCTCAAGT
ATATGTTGCTATGCAAAATCATGGTCAGCCAAGCTGATGATGTTGCACGA
ATAATATCAACCAA
Genomic location of T1074  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1744 marker 1744
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)