SGN Marker T1076

SGN-M1745
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBAN87TH
Arabidopsis best BAC match: AC009755.5
Arabidopsis position: 3.0040000
Arabidopsis identities: 0.753
Best GenBank protein hit: AAF02126.1
Evalue: 3.1e-44
Identities: 0.754
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39488)
Chromosome
2
Position
111.70 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1076 was used as an overgo probe on plate 11 [well F4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGATCCCAAAACACCTTTCTCCAC
B sequence
GGGCATCCAAATAGCTGTGGAGAA
AB sequence
GGATCCCAAAACACCTTTCTCCACAGCTAT
Marker sequence
GGGCAGTCCTGTCCTCCCTCCATCCTATTTCTTTGGAGCTCAAACTGCAA
CCTTAGATTCTTCAAATTTTCCGGATAAAATTACTTCCATTGGTTCTCGA
TTTCATCTGAGAAATAAAATGGATATTGATGAAATACTTGGGGTATCTCG
GCCTGTGAGTTTGACAAACAAGAGTGCTATTTATGTTTGGGGTTACAATC
AATCTGGGCCAACGGGTCGGAGAGGGAAAGAGAGGAGTTTGAGGATCCCA
AAACACCTTTCTCCACAGCTATTTGGATGCCCAGCTCGTGGGAATTCCCG
TTGGTTGGATATTGCTTGTGGTCGTGAGCATACTGCTGCTGTGGCTTCTG
ATGGATCGCTTTTTACATGGGGAGCTAACCAATTTGGTCAACTGGGTGAC
GGAACTGAAAATGCTAGGAAGCACCCCTAGAAAGTGAAACAATTGCCATC
TGAATTTGGGATTA
Genomic location of T1076  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1745 marker 1745
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)