SGN Marker T1078

SGN-M1747
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.13
Tomato EST read: TFBAT03TH
Arabidopsis best BAC match: Z99708.1
Arabidopsis position: 4.1860000
Arabidopsis identities: 0.658
Best GenBank protein hit: CAB16823.1
Evalue: 1.2e-71
Identities: 0.724
Description: aminopeptidase-like protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39489)
Chromosome
12
Position
54.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1078 was used as an overgo probe on plate 4 [well C12]

Plausible BAC Matches:   P105J24

 Overgo Sequences

A sequence
CTGAGGTCTTTGATGGCTTCTCAC
B sequence
CATTGAGAGGAGGAGAGTGAGAAG
AB sequence
CTGAGGTCTTTGATGGCTTCTCACTCTCCT
Marker sequence
GCCAGAACTAACGAAAGAGACAGACGATGGCGGACACTCTCGCAGCTCTG
AGGTCTTTGATGGCTTCTCACTCTCCTCCTCTCAATGCTTTAATCGTTCC
TTCCGAAGATTATCATCAGAGCGAATATGTTTCTGCACGAGATAAGAGGC
GCGATTTCGTCTCTGGATTCACCGGAAGTGCTGGTATAGCGCTTATATCA
ATGAACGAAGCACTTCTGTGGACCGATGGTCGCTACTTTTTGCAGGCAGC
TCATCAGCTTAGTGAGCAATGGAAGCTCATGCGTATGGGAGAAGACCCTG
CACTTGATATTTGGATGGCAGATAATCTGCCAAAGGATGCAGCTATTGGT
GTTGATCCATGGTGTATATCAGTAGATACTGCACAGAAATGGGAGCGTGC
TTTTGCTAAGAAACAGCAAAAGTTGGTTCCAACAGCTAGAAACTTGGTAG
ATGAAGTCTGGAAAAATCAGCCACCTGCCGAAACAAATCCCTTGATCGTG
CATCCTTTAGAATTTGCTGGTCGCTCTGTTGCAGATAAGTTGAAAGATTT
GAGAGCAAAGCT
Genomic location of T1078  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1747 marker 1747
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)