SGN Marker TG20

SGN-M175

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2300
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CTAGGACTTCATCTTTTGTTATTACTTACTGTAAAAAGTTCTTGGCAGATGCAAATAAGGAGTGGCAGGTATCACACACTGCTAATCAAT
GATTCAGCAGCATACTCTTGTGGTTCCAGTTTATGCGGCGTCCTTGGTCATGGGCCTGAAACAACTCAGTGTGTGGAATTTACTCGAATT
AGCTTTCCTGTTCCCGTACAAGTTGCGCAAGTTTCAGCTTCTCATAATCATGCTGCTTTTGTCACAGGGTCTGGACAGGTTTGGCAATCG
GCGTATATTATCAACTACTCTCATTTTTATTACAGTAATTTACCTTTTACGTGCACTTTGTTTTTTGCATGCATGATGTGGAAATCCTCG
TTCTGTTGAGGAGTAAAGTAAAGAAGGTGAAAGAGGAAGAATGAAAATGGAGACAAGCAATCCAATCACATTTTCGTTTTTTTGGGAAAT
TATTTTAGGAGAGGTTCCTTTGGGAGACTGATACTAATATTGTTGAAATATA
Reverse sequence
TTCCAACAGTAGTGAGCAATGTATTATGACAAAACTTAACAGCTTCACGTTTTAGTATGTCTAAAAGAGAATGTTCTTTCCGTGTTAGGC
AACTCTTTATTTCCAACTTTACCACATGGAATGTTTAAGGCATAAGATTAAAGGACATTTTAATACATTCAATATATCCTATTCAAAAAT
CTTCCTTACTTTCTTAAAATCCGTGTCAAATCAAAATCAGACAAATAAATTGAAATGGAGAGAGTACTTTTTCAAAGATACTACAAAATT
AAGCCCAATTTTAAAGATAAACGAACCCAAAACATTTACAGACAATGAAAAAATGCAGAAGAGCATCACATACACATTGCTGGGAACCAA
TTAGATCTGCATTAGCACCGTAACACCTACAATGGTATTTCCAATTTGCAACTAAAACTAATGGACATGTCATAGGTGTTGCCTAACTCT
TAAAAATACCTCGTTTTCATTTTTAGCCTTCATTTAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1526152e-117212 (42.2% of RFLP seq)+
SGN-U1555492.2e-0630 (6.2% of RFLP seq)-
SGN-U1632841.4e-0764 (13.1% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53217)
Chromosome
7
Position
38.94 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53215)
Chromosome
2
Position
71.59 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53216)
Chromosome
7
Position
16.24 cM
Confidence
uncalculated
Protocol
unknown
Subscript
C

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53213)
Chromosome
7
Position
18.80 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43846)
Chromosome
7
Position
80.60 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43306)
Chromosome
7
Position
74.10 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40820)
Chromosome
7
Position
93.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39940)
Chromosome
7
Position
64.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8435)
Chromosome
7
Position
81.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8436)
Chromosome
7
Position
68.80 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8441)
Chromosome
7
Position
18.40 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Potato-TXB 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8440)
Chromosome
2
Position
12.00 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8439)
Chromosome
7
Position
103.00 cM
Confidence
F(LOD3)
Protocol
RFLP
Subscript
A


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG20 was used as an overgo probe on plate 8 [well F11]

Plausible BAC Matches:   P311P20,   P267E15,   P106E01,   P227C07,   P137J06,   P250P10,   P129L05,   P271P04,   P217C05,   P266E15,   P294A04,   P090I08

 Overgo Sequences

A sequence
TTTGTCACAGGGTCTGGACAGGTT
B sequence
TATACGCCGATTGCCAAACCTGTC
AB sequence
TTTGTCACAGGGTCTGGACAGGTTTGGCAA
Marker sequence
CTAGGACTTCATCTTTTGTTATTACTTACTGTAAAAAGTTCTTGGCAGAT
GCAAATAAGGAGTGGCAGGTATCACACACTGCTAATCAATGATTCAGCAG
CATACTCTTGTGGTTCCAGTTTATGCGGCGTCCTTGGTCATGGGCCTGAA
ACAACTCAGTGTGTGGAATTTACTCGAATTAGCTTTCCTGTTCCCGTACA
AGTTGCGCAAGTTTCAGCTTCTCATAATCATGCTGCTTTTGTCACAGGGT
CTGGACAGGTTTGGCAATCGGCGTATATTATCAACTACTCTCATTTTTAT
TACAGTAATTTACCTTTTACGTGCACTTTGTTTTTTGCATGCATGATGTG
GAAATCCTCGTTCTGTTGAGGAGTAAAGTAAAGAAGGTGAAAGAGGAAGA
ATGAAAATGGAGACAAGCAATCCAATCACATTTTCGTTTTTTTGGGAAAT
TATTTTAGGAGAGGTTCCTTTGGGAGACTGATACTAATATTGTTGAAATA
TA
Genomic location of TG20  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D175 marker 175
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)