SGN Marker T1084

SGN-M1750
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.06.01.01
Tomato EST read: TFBAT50TH
Arabidopsis best BAC match: AB023042.1
Arabidopsis position: 5.2390000
Arabidopsis identities: 0.759
Best GenBank protein hit: BAA97369.1
Evalue: 7.7e-77
Identities: 0.747
Description: phosphatidylserine decarboxylase [Arabidopsis thaliana]
Comment: biosynthesis of phosphatidylethanolamine
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49388)
Chromosome
1
Position
84.96 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47323)
Chromosome
1
Position
124.62 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39492)
Chromosome
1
Position
136.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1084 was used as an overgo probe on plate 8 [well B11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATTGCAGTATGTGCTGCTGATTGC
B sequence
TGAATGCCATCAGACGGCAATCAG
AB sequence
ATTGCAGTATGTGCTGCTGATTGCCGTCTG
Marker sequence
GACCGCCGAAAGAAAAGGCTAGTGGAAGAAATAATTGATCGGAAGATAGT
CTTGTCAATGAGGGCTATCTATCAGTCTAAATTTGGCCTTGGCCTTATGG
ATAATGGTGCAAAAGAAATCTTGCGGAGCCTCTCTGAAAAACAGGGCAAG
AAAATGGATACTGCTGAATCTGCCAAGGAAATACCTAACTTCATTGAATT
TTTTAAGGATCAAATAAATATGGATGAAGTCAAGTATCCATTGGAGCAAT
TTAAGACATTCAACGAATTTTTCATAAGAGAGTTGAAGCCTGGTGCAAGA
CCTATTGCTTTTGTAGAACGTGATGATATTGCAGTATGTGCTGCTGATTG
CCGTCTGATGGCATTCAACAGTGTTGCTGATAGTATAAGATGTTGGATCA
AGGGTCGAAAGTTTTCCATCCAAGGTCTGCTGAATGAAACGTGTTCTAGT
GAATTTGTCAATGGATCTCTAGTGATATTTCGCTTGGCACCACAGGACTA
TCATCGTTTCCACTTTCCTGTATCTGGAACTATTGAGAAATTTCTTGAGC
TACCTGGTTGCCTGTAT
Genomic location of T1084  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1750 marker 1750
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)