SGN Marker T1087

SGN-M1752
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBAT68TH
Arabidopsis best BAC match: AC006223.3
Arabidopsis position: 2.1810000
Arabidopsis identities: 0.604
Best GenBank protein hit: AAD39465.1
Evalue: 4.5e-71
Identities: 0.734
Description: PUR alpha-1 [Arabidopsis thaliana]
Comment: similarity with PUR-alpha too low
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39494)
Chromosome
1
Position
31.70 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1087 was used as an overgo probe on plate 9 [well C7]

Plausible BAC Matches:   P271K09,   P159L14,   P045I05,   P241F22,   P131H06,   P134B11,   P256P03,   P216I01,   P148M01,   P319E09,   P101A06,   P256E08,   P316M07,   P115M20,   P016P22,   P052G16

 Overgo Sequences

A sequence
CCAGTCACTCTTCTCAATCTGCTC
B sequence
GTCAAATCAGCTGTGGGAGCAGAT
AB sequence
CCAGTCACTCTTCTCAATCTGCTCCCACAG
Marker sequence
GGCGAGGGCGCTTTCTGAAGGTCTCTGAAGCATCTGTTAGCAGGAACCGT
AGTACCATTATTGTTCCAGCAGGAAGTGCCCGGGATGAGGGATGGGCAGC
ATTTAGGAATATTTTGGCAGAGATTAACGAAGCCTCAAGGCTATTTATTT
CGCCCAATCAGAGTTTGGAAACCTCAGAGCGTCTTGGGCTTTCAGATGAT
GTAGGAGCTGGTTTTATATCCAGTCACTCTTCTCAATCTGCTCCCACAGC
TGATTTGACTATTGAACGGACCATTGATTTGCCAGCAGCTGACGAAGTTA
GTGACGTGGGGGTCTCCAAAGTAATCAGGGTTGACCAGAAGAGGTTCTTC
TTTGATCTTGGGAATAACAATCGGGGCCATTTCTTACGAATATCGGAGGT
AGCAGGTTCTGACCGCTCTTCAATAATTCTTCCCCTTTCTGGCCTGAAAC
AATTTTATGACATGGTGGGTCACTTTGTAGAGATAAGCAAAGATCGCCTC
GAAGGAATTACAGGTGCAAATGTTCGGACAATTGACTCCCCACAGA
Genomic location of T1087  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1752 marker 1752
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)