SGN Marker T1094

SGN-M1759
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBAU15THC
Arabidopsis best BAC match: AL050300.2
Arabidopsis position: 3.1180000
Arabidopsis identities: 0.589
Best GenBank protein hit: CAB43423.1
Evalue: 1.2e-27
Identities: 0.449
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39496)
Chromosome
11
Position
75.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1094 was used as an overgo probe on plate 3 [well H3]

Plausible BAC Matches:   P100L15

 Overgo Sequences

A sequence
AACAGCCCGAATCTCTTTGCCATG
B sequence
TTACGCGATTCGCAAGCATGGCAA
AB sequence
AACAGCCCGAATCTCTTTGCCATGCTTGCG
Marker sequence
GCATGAACCATGGTCTTCTTCTTCTTTACTCCTTTTCCTCTCTATCATTT
CTTTCCTCTTTCCCTTCATTTCTTCATCAAAATCCTCCACAACAATCCCT
CTTTCATTTCTCAACACCAACACAAACCAAGATTTCTACCAAAAACTCAC
TCATTTAGCTTCTTTCTCTTTAGCTAGAGCTCATCATATCAAGAATCCTC
AAGATTCTTCAATTTCCAACATCCCTTTATATCCTCATAGCTATGGAGGC
TACTCAATTACTCTTCCATTTGGTACTCCTCCTCAAAAAATCCCATTTGT
AATGGACACTGGTAGTAGCTTTGTTTGGTTCCCATGTACTAAAAAGTACC
AATGCTCAAAATGTCCTGTTTCTTCACAAAAAAATCCAACTTTTATTCCA
AGATTGTCATCTTCAGCTAGAGTTCTTGGATGTTTGAACCCAAAATGCAG
TTGGATTCACCCAAAAAAAACAGCCCGAATCTCTTTGCCATGCTTGCGAA
TCGCGTAATAGAACAAACTGTAAACATGCTTGTCCACCTTATATGATTCT
TTATGGTTCAGG
Genomic location of T1094  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1759 marker 1759
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)