SGN Marker solcap_snp_sl_100003

SGN-M17591

Synonyms  
1287_1_86_b
1287_1_93
1287_1_93_1287_1_86_b
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53922)
Chromosome
8
Position
57.98 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAACATCAGTCTTAATAATATTATCAGTTACAACCAGAGGCACAGCATGA
  
3' flanking region
GTTTCAGTTGCTTTTGTTATGCATTTAACATTCCCAGTTTCATCCACAAA
SNP nucleotide
AC
SNPdb format
CAACATCAGTCTTAATAATATTATCAGTTACAACCAGAGGCACAGCATGA[A/C]
GTTTCAGTTGCTTTTGTTATGCATTTAACATTCCCAGTTTCATCCACAAA
  
Genomic location of solcap_snp_sl_100003  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17591 marker 17591
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)