SGN Marker solcap_snp_sl_100009

SGN-M17597

Synonyms  
1863_3_511_b
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53928)
Chromosome
6
Position
37.10 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTATTACATTCATACTAATCAATCTGGGGGGAAATATACTTAATCAAGG
  
3' flanking region
CTCCCCTTCNCTCTTCAATGAACANGGATACTGTATGTTCTTTCTTTCCA
SNP nucleotide
AT
SNPdb format
AGTATTACATTCATACTAATCAATCTGGGGGGAAATATACTTAATCAAGG[A/T]
CTCCCCTTCNCTCTTCAATGAACANGGATACTGTATGTTCTTTCTTTCCA
  
Genomic location of solcap_snp_sl_100009  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17597 marker 17597
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)