SGN Marker solcap_snp_sl_100010

SGN-M17598

Synonyms  
1863_3_536_b
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53929)
Chromosome
6
Position
37.10 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGGGGGGAAATATACTTAATCAAGGNCTCCCCTTCNCTCTTCAATGAACA
  
3' flanking region
GGATACTGTATGTTCTTTCTTTCCATACGCGTGCATGATCGTGTTGTTAT
SNP nucleotide
AG
SNPdb format
TGGGGGGAAATATACTTAATCAAGGNCTCCCCTTCNCTCTTCAATGAACA[A/G]
GGATACTGTATGTTCTTTCTTTCCATACGCGTGCATGATCGTGTTGTTAT
  
Genomic location of solcap_snp_sl_100010  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17598 marker 17598
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)