SGN Marker solcap_snp_sl_100014

SGN-M17602

Synonyms  
2325_3_314
2325_3_327_b
2325_3_327_b_2325_3_314
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53933)
Chromosome
1
Position
70.26 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCTAAAGTTATGGTTGATAAGAAAATTCGGGGATCTATTATATGTAACGC
  
3' flanking region
AGTTTAGAAGGGATTTTAGCTGGGGCCGCTTCGNTNGCCTACATTGCGTC
SNP nucleotide
CG
SNPdb format
GCTAAAGTTATGGTTGATAAGAAAATTCGGGGATCTATTATATGTAACGC[C/G]
AGTTTAGAAGGGATTTTAGCTGGGGCCGCTTCGNTNGCCTACATTGCGTC
  
Genomic location of solcap_snp_sl_100014  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17602 marker 17602
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)