SGN Marker solcap_snp_sl_100032

SGN-M17620

Synonyms  
296_1_818
296_1b_107_b
296_1b_107_b_296_1_818
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53951)
Chromosome
11
Position
4.29 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAATTAGCAGCATTAACTATGGCTACAAAGTGAAAGCTAATCACAGATAC
  
3' flanking region
TACATCTCGGTCTGGAACAGTGGCAGTAAAAACGTTATTTTGCAACCTTA
SNP nucleotide
AT
SNPdb format
GAATTAGCAGCATTAACTATGGCTACAAAGTGAAAGCTAATCACAGATAC[A/T]
TACATCTCGGTCTGGAACAGTGGCAGTAAAAACGTTATTTTGCAACCTTA
  
Genomic location of solcap_snp_sl_100032  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17620 marker 17620
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)