SGN Marker solcap_snp_sl_100035

SGN-M17623

Synonyms  
3017_4_184
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70069)
Chromosome
12
Position
41.63 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66387)
Chromosome
12
Position
52.98 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 62884)
Chromosome
12
Position
60.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53954)
Chromosome
12
Position
44.71 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTCCTCCTTAATTTACACACTTGTAATATTATATTATCACCGTATTTTAG
  
3' flanking region
GTATCATAACCAGGAGCGGAGCTAGCCTTGTGTTAGCTGGGTTTCATCAC
SNP nucleotide
TC
SNPdb format
TTCCTCCTTAATTTACACACTTGTAATATTATATTATCACCGTATTTTAG[T/C]
GTATCATAACCAGGAGCGGAGCTAGCCTTGTGTTAGCTGGGTTTCATCAC
  
Genomic location of solcap_snp_sl_100035  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17623 marker 17623
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)