Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_100043

SGN-M17631

Synonyms  
3300_2_283
3300_2_293_b
3300_2_293_b_3300_2_283
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70075)
Chromosome
4
Position
60.85 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53962)
Chromosome
4
Position
57.61 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGCTATATTGAATTATTGAGTTCTTTTGTCAATGTGCAGCAATTAGAAGA
  
3' flanking region
GAGGATGAGTTTGTTGCACTGTTAAGGGCCACCATAAAAGGTCTTGTCTA
SNP nucleotide
TC
SNPdb format
TGCTATATTGAATTATTGAGTTCTTTTGTCAATGTGCAGCAATTAGAAGA[T/C]
GAGGATGAGTTTGTTGCACTGTTAAGGGCCACCATAAAAGGTCTTGTCTA
  
Genomic location of solcap_snp_sl_100043  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17631 marker 17631
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)