SGN Marker solcap_snp_sl_100045

SGN-M17633

Synonyms  
4301_3_228_b
4301_3_228_b_CL003893-0365
CL003893-0365
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53964)
Chromosome
4
Position
63.42 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTGAAGTGTTGCTTGGTGGTGATGATGGGAGTCTAGCTTTTATTCCTGG
  
3' flanking region
AACTTCAGCGTTAGTGCTGGTGAGAAAATTACATTCAAGAACAATGCAGG
SNP nucleotide
AG
SNPdb format
CTTGAAGTGTTGCTTGGTGGTGATGATGGGAGTCTAGCTTTTATTCCTGG[A/G]
AACTTCAGCGTTAGTGCTGGTGAGAAAATTACATTCAAGAACAATGCAGG
  
Genomic location of solcap_snp_sl_100045  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17633 marker 17633
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)