SGN Marker solcap_snp_sl_100070

SGN-M17657

Synonyms  
C2_At2g15890_430_b
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53988)
Chromosome
1
Position
87.80 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TACCCAAGTCTTGGTTAACATAGTTACTTGACAGCTGCGCCTGAGGAATT
  
3' flanking region
CAAATTGACCTGGACATCACAGTTATTAAAGAAAAAGTTCATCAAGCCAA
SNP nucleotide
AT
SNPdb format
TACCCAAGTCTTGGTTAACATAGTTACTTGACAGCTGCGCCTGAGGAATT[A/T]
CAAATTGACCTGGACATCACAGTTATTAAAGAAAAAGTTCATCAAGCCAA
  
Genomic location of solcap_snp_sl_100070  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17657 marker 17657
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)