SGN Marker T1106

SGN-M1766
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.01
Tomato EST read: None
Arabidopsis best BAC match: AB024033.1
Arabidopsis position: 3.0180000
Arabidopsis identities: 0.842
Best GenBank protein hit: CAA88840.1
Evalue: 2e-102
Identities: 0.925
Description: phosphoglycerate kinase (PGK) [Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39501)
Chromosome
7
Position
95.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1106 was used as an overgo probe on plate 7 [well F12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGCAAAATGGTGCCAGAGTCATCC
B sequence
CCAAGATGAGAGGCAAGGATGACT
AB sequence
TGCAAAATGGTGCCAGAGTCATCCTTGCCT
Marker sequence
TTGAATTCTCCGACGAAATTAACGATTGAAGAATGGCGGTGAAGAAGAGT
GTCGGATCACTGAAAGAAGCAGATCTGAAAGGGAAGAGAGTATTCGTCCG
AGTTGATCTCAACGTTCCATTGGATGATAACTTCAAAATCACTGATGACA
CCAGAATCCGGGCTGCTGTACCTACCATCAAGTACTTGATGCAAAATGGT
GCCAGAGTCATCCTTGCCTCTCATCTTGGTCGCCCCAAAGGTGTCACTCC
AAAGTACAGCTTAAAGCCACTTGTGCCTAGACTTTCAGAACTATTGGGAA
TCGAGGTCAAGATGGCAAATGATTCAGTTGGCCCAGAAGTTGAGAACTTG
GTGGCTGGACTACCGGAAGGAGGAGTTGTACTTCTGGAGAATGTGCGATT
TTACAAAGAAGAGGAGAAGAATGACCCCGAGTTTGCCAAGAAGTTGGCAT
CTCTTGCAGATTTGTACGTCAATGATGCATTTGGGACTGCTCACAGAGCC
CATGCTTCCACGGAAGGGGTTGCTAAGGTCTTGAAACCAGCCGTTGCTGG
ATTCCTTATGCAAAAGGAACTTGACTATTTAGTTGGAGCTGTGTCAAATC
CACAGAAGCCATTTGCTGCTATTGTTGGTGGTTCAAAAGT
Genomic location of T1106  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1766 marker 1766
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)