SGN Marker solcap_snp_sl_100074

SGN-M17661

Synonyms  
C2_At2g22570_935_b
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53992)
Chromosome
11
Position
3.71 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTGGATAACTCGTTAGTTTCGCTAAGCAATTCATGTGATTCTTATTCCTC
  
3' flanking region
TATATCAGTTAGATTGTGATTTTGTGCCATTTGTTTTGCTATAGGCTCCG
SNP nucleotide
AT
SNPdb format
GTGGATAACTCGTTAGTTTCGCTAAGCAATTCATGTGATTCTTATTCCTC[A/T]
TATATCAGTTAGATTGTGATTTTGTGCCATTTGTTTTGCTATAGGCTCCG
  
Genomic location of solcap_snp_sl_100074  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17661 marker 17661
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)