SGN Marker T1107

SGN-M1767
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 4.05.01.04
Tomato EST read: None
Arabidopsis best BAC match: AC016162.3
Arabidopsis position: 1.1393000
Arabidopsis identities: 0.818
Best GenBank protein hit: AAC26484.1
Evalue: 7.0e-72
Identities: 0.809
Description: putative JUN kinase activation domain binding protein
Comment: "probable COP9 proteasome complex, nuclear. Highly conserved between plants and mammals."
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39502)
Chromosome
4
Position
67.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1107 was used as an overgo probe on plate 6 [well H10]

Plausible BAC Matches:   P311L20

 Overgo Sequences

A sequence
CCTCACTACTTCAAGCGTGTGAAG
B sequence
GAGCAAGAGCAGAGATCTTCACAC
AB sequence
CCTCACTACTTCAAGCGTGTGAAGATCTCT
Marker sequence
ACGTATCGTCGGCGGCGATGGCTCAGCAAACCTGTGAGTTAGAGAACAAC
ATCTTAACAATCGACGCGCCGTCGGGGTCGATACCGGAAAACTCCGCGTC
GGACGCTATATTCCACTACGACGATGCGGAACAGACGAAGTTTCAACGGG
AGAAGCCGTGGGCGAGTGACCCTCACTACTTCAAGCGTGTGAAGATCTCT
GCTCTTGCTCTTCTCAAGATGGGTGTTCACGCGCGTTCCGGAGGTACAAT
TGAGGTCATGGGACTCATGCAGGGTAAGACTGACGGCGATGCCATCATTG
TAATGGACGCTTTTGCCCTCCCCGTTGAAGGCACTGAAACTAGGGTTAAT
GCTCAAGCTGATGCGTATGAATATATGGTCGAATATTCACAGACCAACAA
GCAGGCTGGTCGTTTGGAAAATGTGGACGGGTGGTACCATTCCCATACTG
GTTATGGATGCTGGCTCTCTGGCATTGATGTATCTACCCGAATG
Genomic location of T1107  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1767 marker 1767
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)