SGN Marker T1110

SGN-M1769
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBBA21TH
Arabidopsis best BAC match: Z97341.2
Arabidopsis position: 4.0900000
Arabidopsis identities: 0.657
Best GenBank protein hit: CAB46039.1
Evalue: 4.1e-38
Identities: 0.612
Description: HSP like protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39504)
Chromosome
7
Position
35.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1110 was used as an overgo probe on plate 10 [well A1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AAGAACTTGCTGCACGCCCTGCTT
B sequence
CGAGCATGATCAGATGAAGCAGGG
AB sequence
AAGAACTTGCTGCACGCCCTGCTTCATCTG
Marker sequence
GATGAATAAAGAAGAAGAACAGCTGAATTGAAGAATAGCTTGGAAGGATA
CATATATGATACGAGAGACAAGCTTGAATCTGGAGATTTTGTGACAATAT
CAACCAGTCAAGAGCGCCAGTCCTTTATTCAGAAACTTGATGAGGTACAA
GAATGGTTGTACACAGATGGTGAAGATGCTTTTGCCAAGCAGTTTCAAGA
ACATTTAGATAAGTTGAAAGCTATTGGGGATCCCATATTTTTCAGACATA
AAGAACTTGCTGCACGCCCTGCTTCATCTGATCATGCTCGCAAATACCTT
AATGAAGTGCAACAGATTGTGCGTGGATGGGAAACCAACAAATCGTGG
Genomic location of T1110  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1769 marker 1769
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)