Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_100127

SGN-M17708

Synonyms  
CL009086-0314
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54039)
Chromosome
4
Position
59.68 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCTTAAGTTACTGGTACTGCAGTCAGTATTCCGTAACATATTTGATAGCACATTTGATANTCAACTTCTTGAATAACTTCAAGAACAACAACTTTGTAAG
  
3' flanking region
ACATATCTGTCATGCATCTTAAGTTTGACAAGTGATGATACTTTGTATTGCTTGGTATCACAGGTTTTANTTGGAATTGCATTGAAATTACCACACGTTA
SNP nucleotide
AC
SNPdb format
CCTTAAGTTACTGGTACTGCAGTCAGTATTCCGTAACATATTTGATAGCACATTTGATANTCAACTTCTTGAATAACTTCAAGAACAACAACTTTGTAAG[A/C]
ACATATCTGTCATGCATCTTAAGTTTGACAAGTGATGATACTTTGTATTGCTTGGTATCACAGGTTTTANTTGGAATTGCATTGAAATTACCACACGTTA
  
Genomic location of solcap_snp_sl_100127  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17708 marker 17708
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)