SGN Marker T1112

SGN-M1771
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.01
Tomato EST read: TFBBA37TH
Arabidopsis best BAC match: AC005967.2
Arabidopsis position: 2.1370000
Arabidopsis identities: 0.872
Best GenBank protein hit: AAB47571.1
Evalue: 6.9e-51
Identities: 0.922
Description: non-phosphorylating glyceraldehyde dehydrogenase [Nicotiana plumbaginifolia]
Comment: oxidiation of D-glyceraldehyde-3-phosphate (G3P) to 3-phospho-D-glycerate (PGA) in cytosol: photoassimilate metabolism
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39505)
Chromosome
7
Position
0.40 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1112 was used as an overgo probe on plate 1 [well C5]

Plausible BAC Matches:   P232G04,   P150H03

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CACTATGGAAAAGAGCAGAGTTAC
B sequence
GCAGCTGCCTTATGAAGTAACTCT
AB sequence
CACTATGGAAAAGAGCAGAGTTACTTCATA
Marker sequence
TCCACCATTTTCTGTTCTTATCCTTTTTTTTTTTAATTATTGTGAAAAAA
AATCTAAAATTTGGTGTAAAAATGGCTGGAAATGGAGTATTTGCAGAAAT
AATTGATGGAGAAGTGTACAAATATTATTGTGAAGGAGAATGGAAAAAAT
CAGCTTCTGGAAAATCTGTTGCTATTATTAATCCTACTACAAGAAAGACA
CAATACAAAGTTCAAGCATGTACACAAGAAGAGGTGAACAAAGTAATGGA
AATAGCAAAAGCAGCACAAAAATCATGGGCTAAAACACCACTATGGAAAA
GAGCAGAGTTACTTCATAAGGCAGCTGCAATTTTGAAAGAACACAAAGCC
CCTATTGCTGAATGCCTTGTTAAAGAAATTGC
Genomic location of T1112  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1771 marker 1771
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)