SGN Marker solcap_snp_sl_100145

SGN-M17725

Synonyms  
CL009183-0232
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54056)
Chromosome
4
Position
61.18 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTTCTACTGATGCTGGCAAGGAACTCATTAANAAAATTGGTCTCGTTTACCAAATCAACATCGCACCTAAGGTTTAATTTTCCCCTAATTTTT
  
3' flanking region
TATNNATGTTNTTNTTTT
SNP nucleotide
AG
SNPdb format
CTTTCTACTGATGCTGGCAAGGAACTCATTAANAAAATTGGTCTCGTTTACCAAATCAACATCGCACCTAAGGTTTAATTTTCCCCTAATTTTT[A/G]
TATNNATGTTNTTNTTTT
  
Genomic location of solcap_snp_sl_100145  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17725 marker 17725
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)