SGN Marker T1117

SGN-M1774
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.06.01
Tomato EST read: TFBBA93TH
Arabidopsis best BAC match: AC011915.3
Arabidopsis position: 1.1334000
Arabidopsis identities: 0.797
Best GenBank protein hit: AAG12727.1
Evalue: 8.0e-69
Identities: 0.810
Description: hypothetical protein; 60972-62575 [Arabidopsis thaliana]
Comment: 5.00 e-68 match with gb|AAF16606.1|AC011915_9 (AC011915) very-long-chain fatty acid condensing enzyme (CUT1);
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49391)
Chromosome
2
Position
29.79 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47326)
Chromosome
2
Position
14.89 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39506)
Chromosome
2
Position
12.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14084
Forward primer (5'-3')
CAACTCCGTCTTTGTCAGCC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCTTTGTCGTCTGCACCCT
Enzymes
  
Accessions and product sizes
Approximate temperature
61°C
  
Overgo hybridization and physical mapping 
T1117 was used as an overgo probe on plate 11 [well H8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AAGAGCAATGCTCCTCCCGAATTG
B sequence
TCCCATTCGGAACAAACAATTCGG
AB sequence
AAGAGCAATGCTCCTCCCGAATTGTTTGTT
Marker sequence
AGTTCACATCCATTGTTGACTTAATGAACAAAACAAGGCTGAAACCAAAA
GACATTGATATTCTTATTGTGAATTGCAGCTTATTTTCTCCAACTCCGTC
TTTGTCAGCCATGGTAATCAACAAATATAAATTACGAAGCAACATAAAAA
GTTACAATCTCTCTGGTATGGGATGCAGTGCTGGTTTAATCTCGATCGAT
TTAGCTCGAGATCTTCTTCAAGTACATCCAAATTCATATGCTTTAATTAT
TAGCACTGAGATAATAACCCCCAATTATTACAGAGGTTCAGAAAGAGCAA
TGCTCCTCCCGAATTGTTTGTTCCGAATGGGAGGTGCAGCAATACTTTTA
TCCAACANAGAACGCGATCAATACAGAGCCAAGTACAGGCTAATGCACGT
GGTCCGCACCCATAAGGGTGCAGACGACAAAGCATTTAAATGTGTATTTG
AACAACAAGATTC
Genomic location of T1117  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1774 marker 1774
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)