SGN Marker solcap_snp_sl_100170

SGN-M17745

Synonyms  
CL015004-0352
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54076)
Chromosome
3
Position
61.49 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGTCACACAGGTTTGNTATGGATCTTCTTGACCTTTTTACTTTTATCATACCAGAGATCTTGTATAAGTACCTTCACAACTTGCTTGCTTTTCATTAGTT
  
3' flanking region
TTCATCTAAATGTCAGAAAAATATGATGCTTGAAAGACAAGGTGGAACACANTACACAAC
SNP nucleotide
AG
SNPdb format
TGTCACACAGGTTTGNTATGGATCTTCTTGACCTTTTTACTTTTATCATACCAGAGATCTTGTATAAGTACCTTCACAACTTGCTTGCTTTTCATTAGTT[A/G]
TTCATCTAAATGTCAGAAAAATATGATGCTTGAAAGACAAGGTGGAACACANTACACAAC
  
Genomic location of solcap_snp_sl_100170  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17745 marker 17745
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)