SGN Marker solcap_snp_sl_100192

SGN-M17764

Synonyms  
CL015166-0691
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54095)
Chromosome
11
Position
51.15 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGCAATCCTTCACATTNAAGTGAGCTTGTGTTGGCGACCTGGCCACTTTTATACTTAGTTCTGGCATTCCCTGTTTAACTAGTCTTTTAACATCTCAACC
  
3' flanking region
TTCAATCCTTGGATTGAACAGNAGTCCTGAAATGTAATATTTTTGGGTCATANTTAACNAAATGCTGCATTNTAATCCCCGTCTAGACCTTTGAGTATCT
SNP nucleotide
AT
SNPdb format
AGCAATCCTTCACATTNAAGTGAGCTTGTGTTGGCGACCTGGCCACTTTTATACTTAGTTCTGGCATTCCCTGTTTAACTAGTCTTTTAACATCTCAACC[A/T]
TTCAATCCTTGGATTGAACAGNAGTCCTGAAATGTAATATTTTTGGGTCATANTTAACNAAATGCTGCATTNTAATCCCCGTCTAGACCTTTGAGTATCT
  
Genomic location of solcap_snp_sl_100192  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17764 marker 17764
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)