SGN Marker T1122

SGN-M1777
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 5.04
Tomato EST read: TFBBC16TH
Arabidopsis best BAC match: Z97341.2
Arabidopsis position: 4.0900000
Arabidopsis identities: 0.846
Best GenBank protein hit: CAA09214.1
Evalue: 1.7e-66
Identities: 0.836
Description: RNA helicase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49392)
Chromosome
4
Position
63.12 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47327)
Chromosome
4
Position
121.60 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39509)
Chromosome
4
Position
131.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1122 was used as an overgo probe on plate 7 [well G9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AAACCTTTGCGCCTGTCAGCTGAT
B sequence
GCCGTTTTGTAGATGGATCAGCTG
AB sequence
AAACCTTTGCGCCTGTCAGCTGATCCATCT
Marker sequence
GGTCTACTGGAGCTGGGTTTCAGTGCTGAAATTCGTGAGCTGGTTAGATT
GTGTCCGAAGCGGAGACAGACCATGTTGTTTTCTGCGACAATGACTGAGG
AAGTTGATGAGCTCATCAATCTCTCACTGAATAAACCTTTGCGCCTGTCA
GCTGATCCATCTACAAAACGGCCTGCAACATTGACTGAAGAGGTAGTTAG
AATACGGCGCATGCGTGAAGGAAATCATGAAGCTGTTCTCCTTGCACTGT
GCACCAAGACTTTCACTTCCAAAGTGATTGTTTTCAGTGGTACAAAGCAT
GCAGCTCATCGGTTGAAAATTATATTTGGTTTACTTGGTTTCAAAGCAGC
TGAGCTACATGGAAATCTTACGCAAGCCCAGCGTCTAGATGCTTTGGAAC
TTTTCAGAAGACAGGAAGTGGATTTTTTGATTGCAACCGATGTTGCAGCT
CGTGGACTTGACAT
Genomic location of T1122  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1777 marker 1777
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)