SGN Marker solcap_snp_sl_100201

SGN-M17773

Synonyms  
CL015215-0121
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54104)
Chromosome
6
Position
0.39 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGCTTGGTGCAATACCGAAACTGTTTAAGTGACATTGCTATTAACCCCAGTTGTCCTTCAGAATCTGACAGATGATGGACTTTCTTGTATA
  
3' flanking region
CGATGTGCAAAAATCTGGTGTCTCTCAATTTGACATGGTATGTATCCTANGTATATTTCATTTTCATTGGGAGCAAAAGGAGATGCAATTGTATGTTATT
SNP nucleotide
TG
SNPdb format
TGCTTGGTGCAATACCGAAACTGTTTAAGTGACATTGCTATTAACCCCAGTTGTCCTTCAGAATCTGACAGATGATGGACTTTCTTGTATA[T/G]
CGATGTGCAAAAATCTGGTGTCTCTCAATTTGACATGGTATGTATCCTANGTATATTTCATTTTCATTGGGAGCAAAAGGAGATGCAATTGTATGTTATT
  
Genomic location of solcap_snp_sl_100201  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17773 marker 17773
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)