SGN Marker T1125

SGN-M1780
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBBC61TH
Arabidopsis best BAC match: AC004512.1
Arabidopsis position: 1.1264000
Arabidopsis identities: 0.529
Best GenBank protein hit: AAC27152.1
Evalue: 3.9e-48
Identities: 0.576
Description: Similar anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49394)
Chromosome
11
Position
2.82 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47329)
Chromosome
11
Position
34.29 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39511)
Chromosome
11
Position
22.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1125 was used as an overgo probe on plate 3 [well H9]

Plausible BAC Matches:   P028H07

 Overgo Sequences

A sequence
ATTGTGACGGAACGACTCCGAATC
B sequence
GAACCCTAGATAACGCGATTCGGA
AB sequence
ATTGTGACGGAACGACTCCGAATCGCGTTA
Marker sequence
CAAAACACAAACTTGTATCAGTATATTCAATATTTCAATATGGGAACCCT
ATACCAACCTCTTGAATCAACAATCCAAGACCTAAAAGTCACAATCCATA
ACACTAGCTTAGTCTTCCCATCACAAGAAACTCCAAAAAAACCTATGTTC
TTACCAAATATTGATCAAGTCCTCAATTTTGATGTCCAAACACTACATTT
TTTCAATGCAAATCCTGAATTTCCACCAGAAATTGTGACGGAACGACTCC
GAATCGCGTTATCTAGGGTTCTTGTTCCTTATGATTTTTTGGCTGGGAGA
CTTAGGATGAATCAAGAGTCAAAAAGATTGGAATTTGATTGTAATAGTGA
TGCTGGAGCTGTATTTATGGTTGCTTCAAGTGAATTAACATTGAATGAGA
TTGGTGATTTAGTTTACCCTAATCCTGGTTTTAGACAATTAATTGTTCAT
GAGAACATTGATATTTTGGAAAAAGATGATAAACCACTTTGCATTCTCCA
GGTTACATCATACAAGTGTGGTGGTTTTGCAATGGGC
Genomic location of T1125  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1780 marker 1780
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)