SGN Marker solcap_snp_sl_100245

SGN-M17815

Synonyms  
CL015472-0519
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54146)
Chromosome
4
Position
61.69 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACTCCGAGCTATTTGAAACTCTGGAAAACGAACTCTCCACGAAAGGTAAAGCTGGGCTCAATGCAGCAAATGATCAAGCTGCATTTAACTTCCTGGCTAG
  
3' flanking region
TCTTTATATGGCATTAATCCTCAAGACACCGAACT
SNP nucleotide
AG
SNPdb format
ACTCCGAGCTATTTGAAACTCTGGAAAACGAACTCTCCACGAAAGGTAAAGCTGGGCTCAATGCAGCAAATGATCAAGCTGCATTTAACTTCCTGGCTAG[A/G]
TCTTTATATGGCATTAATCCTCAAGACACCGAACT
  
Genomic location of solcap_snp_sl_100245  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17815 marker 17815
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)