SGN Marker T1129

SGN-M1782
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.03.16.01
Tomato EST read: TFBBD16TH
Arabidopsis best BAC match: AC003000.2
Arabidopsis position: 2.2150000
Arabidopsis identities: 0.698
Best GenBank protein hit: BAA84468.1
Evalue: 4.9e-79
Identities: 0.775
Description: RNase NGR2 [Nicotiana glutinosa]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39513)
Chromosome
1
Position
137.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1129 was used as an overgo probe on plate 10 [well D3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACTGGCCTTCTTTTAGTTGCAAGG
B sequence
TGACAAGTTGAGGTGGCCTTGCAA
AB sequence
ACTGGCCTTCTTTTAGTTGCAAGGCCACCT
Marker sequence
GTGCCGCTCAAACTCACCATCAATATTCACTATTCATGGACTTTGGGCTG
ATTACAATGACGGAACGTGGCCTGCATGTTGTTCTGGCCCCCAATTTGAT
AAGGAGCAGATTTCAACATTGCGTAAGCCTATGAAGAAGTACTGGCCTTC
TTTTAGTTGCAAGGCCACCTCAACTTGTCATCACGAAAAAGGATCATTTT
GGGCTCATGAGTGGGAAAAACACGGGACATGTTCTTATCCAGTTGTCCAC
GATGAGTATGAGTACTTCCTGATGACTTTGAATGTTTACTTCAAATATAA
CGTCACTGGAATTCTGTTTGAAGCCGGGTATGTACCCTCAAATTCTGAGA
AATATCCACTGGGAGGCATCATTTCAGCCATTCAAAATGCCTTTCATGCA
ACTCCAGAGTTGATATGCTCAAGCGATGCGGTGGAGGAACTAAGAATATG
CTTCTATAAAGATTTACAGCCTCGTGATTGTGCAAGTGGTTCTATCATCA
AAAGTGG
Genomic location of T1129  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1782 marker 1782
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)