SGN Marker solcap_snp_sl_100250

SGN-M17820

Synonyms  
CL015521-0417
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54151)
Chromosome
3
Position
60.39 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GATTGTCAATGTTCTCAAAGGAGAAGGCAATGAAGTGCTCGAGTTTGTTTGTTCTGCATGGCCAAACAGCGTTGAGATTCGTAAAGTTTACATGCGTGGA
  
3' flanking region
AGAATGGCACAGTGGATCAGNCTTATGTAGGCCCTCCATTTAAGTATGTATCTCTGATCTNAATTCCCCTATCTCCATCTTGCTTGCTTAGCTTTCTTAT
SNP nucleotide
AC
SNPdb format
GATTGTCAATGTTCTCAAAGGAGAAGGCAATGAAGTGCTCGAGTTTGTTTGTTCTGCATGGCCAAACAGCGTTGAGATTCGTAAAGTTTACATGCGTGGA[A/C]
AGAATGGCACAGTGGATCAGNCTTATGTAGGCCCTCCATTTAAGTATGTATCTCTGATCTNAATTCCCCTATCTCCATCTTGCTTGCTTAGCTTTCTTAT
  
Genomic location of solcap_snp_sl_100250  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17820 marker 17820
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)