SGN Marker T1130

SGN-M1783
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBBD17TH
Arabidopsis best BAC match: AB006708.1
Arabidopsis position: 5.0370000
Arabidopsis identities: 0.578
Best GenBank protein hit: BAB09823.1
Evalue: 9.0e-32
Identities: 0.544
Description: similar to unknown [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49395)
Chromosome
3
Position
58.50 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47330)
Chromosome
3
Position
81.56 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39514)
Chromosome
3
Position
102.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1130 was used as an overgo probe on plate 1 [well F10]

Plausible BAC Matches:   P298I16

 Overgo Sequences

A sequence
GGCTAAGAGGCTGAAAAGTGATGG
B sequence
GCTGAAGCTCTAAGTGCCATCACT
AB sequence
GGCTAAGAGGCTGAAAAGTGATGGCACTTA
Marker sequence
GCAAGCAAGCAGTGGCTAAGAGGCTGAAAAGTGATGGCACTTAGAGCTTC
AGCCACCGCTAAATCACCTCTTCCTCTGCCCCCTCCTCCTCCTCCTTCTT
CTTCTTCTACTTCATCACCACCTAAAGTTTTTAGTCTTCCTAAACTTACT
CAAAAACCTGTATCAGTATCATTCTCTACATCCACTGCACTTTTCCTCTT
TCCACTTTTCACTGCGACCCATGAAGCAAGAGCAATCAACTTACCCAAGG
AAGACATCGTCTCTTCCCTTAATCAGGTAGAATCGGTAGTTAATCAAGCG
CAAGAGGTTGGTTCGAACATCTTTGATACTGTAAGCGGAGTGATTGGGCC
CGTGATTGAATTTGTGAAACCCGGGATTGATGCAGCATTACCTTTAGTAA
AGCAGGCACGAGAGGAAGTTTTAAAGAATGCTTCTCCTGTCATATCGGAT
GCCACTAAGAAAGCCCAAGAAGCAATGCAGAGTGCTGGCATGGACTCTGA
GCCAGTGATGACTGCAGCTAAGACAGTAGTTGATGCAGCTCA
Genomic location of T1130  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1783 marker 1783
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)