SGN Marker T1131

SGN-M1784
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 9.01
Tomato EST read: TFBBD21TH
Arabidopsis best BAC match: AC011661.5
Arabidopsis position: 1.0350000
Arabidopsis identities: 0.826
Best GenBank protein hit: AAF16642.1
Evalue: 5.8e-49
Identities: 0.662
Description: similar to endoxyloglucan transferase [Arabidopsis thaliana]
Comment: cell wall biosynthesis
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39515)
Chromosome
3
Position
59.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1131 was used as an overgo probe on plate 6 [well G1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AAATTGGTGGGAGGTGACTCTGCT
B sequence
AAGCTGTCACAACACCAGCAGAGT
AB sequence
AAATTGGTGGGAGGTGACTCTGCTGGTGTT
Marker sequence
AATTCCATTTATTTTTTTTAAAATTTTGGGGAGAAAATGGCTTCTCCTAT
AGCTTATTTTCTTGTACTTAGTGCAATAATTGTTGTACTTTTTTCATCAA
CACAAGCTGAAGTACAAGGTTCATTTGATGACAATTTTAGTAAAAGTTGT
CCAGAAACTCATTTCAAGACTTCTGAAGATGGACAGATCTGGTATTTATC
ATTGGACAAAAAAGCAGGATGTGGATTTATGACCAAACAGAAATATAGAT
TTGGGTGGTTTAGCATGAAGTTGAAATTGGTGGGAGGTGACTCTGCTGGT
GTTGTGACAGCTTACTATATGTGCACAGAAGATGGAGCAGGACCGACACG
AGATGAATTACATTTTGAGTTCTTGGGGAATAGGACAGGTGAACCTTATC
TTATTCAAACAAATGTGTACAAGAATGGAACTGGTGATCGTGAGATGAGA
CATGTTTTATGGTTTGACCCCACTGGAG
Genomic location of T1131  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1784 marker 1784
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)