SGN Marker T1132

SGN-M1785
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBBD39TH
Arabidopsis best BAC match: AF000657.1
Arabidopsis position: 1.0490000
Arabidopsis identities: 0.721
Best GenBank protein hit: AAB72162.1
Evalue: 5.7e-18
Identities: 0.721
Description: probable thiamin biosynthetic enzyme [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39516)
Chromosome
1
Position
131.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1132 was used as an overgo probe on plate 8 [well D8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTTTGCACGTCAAGGCGATGCAAG
B sequence
GTGGCAAACTAACCGTCTTGCATC
AB sequence
TTTTGCACGTCAAGGCGATGCAAGACGGTT
Marker sequence
TTGCCATTCCTTCGCTTGCTACCCTAGGGTATTTACGAAGCTGGCGGCTG
CTATGAAAAAAAACTACACTCGATTCTCATATGAATTTCAATTGTTAGAT
TCCAGTTCTGTTGAGTCCCGGCGTAGCTTGTATCAAAAGCTTTCATCAGT
ATAGGTTTTTGCACGTCAAGGCGATGCAAGACGGTTAGTTTGCCACGCCT
ACGTCGTGCGATGAGTCCAAAGTTAGAGTTCCTCATGTTCTGACGGTTGC
CGGGTCCGATTCCGGCGCCGGCGCCGGAATTCAAGCGGATATCAAGGCTA
GTGCTGCTCGGGGAGTGTATTGCTCCACTGTGATCACGGCTGTTACTGCT
CAAGATACCGTAGGGGTTCAGGGTGTGAACATTGTGCCTGAGGATTT
Genomic location of T1132  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1785 marker 1785
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)