SGN Marker solcap_snp_sl_100301

SGN-M17867

Synonyms  
CL015762-0109
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54198)
Chromosome
4
Position
31.10 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTTGCTGTGGTTGGTGGTGGCCCTGCAGGACTTGCTNTNGCACAGCAAGTTTCTGAAGCAGGACTCTCTGTTTGTTCAATTGATCCGAATCCTA
  
3' flanking region
ATTGATATGGCCTAATAACTANGGTGTTTGGGTGGATGAATTTGAGGCTATGGACTTGTTAGATTGTCTAGATGCTACCTGGTCTGGTGCAGCAGTGTAC
SNP nucleotide
AT
SNPdb format
TCTTGCTGTGGTTGGTGGTGGCCCTGCAGGACTTGCTNTNGCACAGCAAGTTTCTGAAGCAGGACTCTCTGTTTGTTCAATTGATCCGAATCCTA[A/T]
ATTGATATGGCCTAATAACTANGGTGTTTGGGTGGATGAATTTGAGGCTATGGACTTGTTAGATTGTCTAGATGCTACCTGGTCTGGTGCAGCAGTGTAC
  
Genomic location of solcap_snp_sl_100301  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17867 marker 17867
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)