SGN Marker TG27

SGN-M179

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2600
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
TG27 image not available
Forward sequence
TGATACTACCAATTTTGTCGGTGTCAACCCGCTCGAACCACTCTCTCAAACTCGCCGAGTTCTCCATCTTCTCTTCTAACCCTCAACACA
ATGAATGAAAAATTTTCAACTTTTTTTGTAAAGAAGACTTAGAGCTATCACATATTATTATAATATTTTTTCTTTTTATCTAAAATTGAA
ATTAAATATATAAGAAGTTATGTTTTATAGTTTTTACGACGAATATTTGATTGTTATTCTAAAAACATGTTATTTTTATAAAAATTCATT
TTACGGAAAAATTTGAAAAAAATAATAACAGTGAAAGTGCAAAAAAGAAACGGAATATAAGTTCTTGAATGATTTCTCAAATTTCAGTAT
AACTTGGAGTTGTATTCAGTTTTTGTTTGGCCAAAAATTAATTTTCAAATATAATAAAAATATTTGAAAAAATTATAATAGATCAAACGA
GTCTTTAGACTTTAAGTGTTCTAATTTAACATTTAAGTTTATTTT
Reverse sequence
GCGGTTTTCAACAACCAAAAACAAAAATGGAAGAGGATCCAATGATATTTTTTTGCTCAAGCGGATATAAATAATATAAGTTCTGCTAAG
TTGGTTTGATCTGTCCACTTAATCTACATGATTTGAAGAAGTAATTTTGCAAGTAATATATCTAAAATATTGTAAACGCAGTTCTCAATG
TGACAAGTCCTTTTTCCAACTTTTTAAACGCCCAACTGCCTGATCTCAATAGCAAGAAATACTTCCAATTGCTGAGTTGCATTGATGGTC
ACAAAAGTTAAGTTACATTATCCAGTGGATCAAGAAATTATGGTATAATCCACGAGAAAGACGATTAATCCAAGTAACAATTTTGCATTT
GGTGAGTTAATTCTATTGATAAAATAAATAAGGTTTTATCCCCTATAATATTTTTTTGGATAAAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1448494.5e-2663 (12.7% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53245)
Chromosome
1
Position
109.03 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50361)
Chromosome
1
Position
90.00 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48295)
Chromosome
1
Position
153.71 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39970)
Chromosome
1
Position
165.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8458)
Chromosome
1
Position
133.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8462)
Chromosome
1
Position
75.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Other PCR data 
PCR data   Exp. ID 14005
Forward primer (5'-3')
GCCGAGTTCTCCATCTTCTCT
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GCGGTTTTCAACAACCAAAA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2500
Solanum lycopersicum LA925: 2100
Approximate temperature
60°C
  
PCR data   Exp. ID 14005
Forward primer (5'-3')
GCCGAGTTCTCCATCTTCTCT
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GCGGTTTTCAACAACCAAAA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2100
Solanum pennellii LA716: 2500
Approximate temperature
60°C
  
PCR data   Exp. ID 14082
Forward primer (5'-3')
GCCGAGTTCTCCATCTTCTCT
Digested band sizes (using AccI)
Solanum lycopersicum LA925: 2000
Solanum pimpinellifolium LA1589: 1100+1300
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GCGGTTTTCAACAACCAAAA
Enzymes
  
Accessions and product sizes
Approximate temperature
55°C
  
PCR data   Exp. ID 19
Forward primer (5'-3')
Unknown
Digested band sizes (using unknown)
Solanum lycopersicum LA925: 2100
Solanum pennellii LA716: 2500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2100
Solanum pennellii LA716: 2500
Approximate temperature
60°C
  
Overgo hybridization and physical mapping 
TG27 was used as an overgo probe on plate 3 [well E5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCTCGAACCACTCTCTCAAACTCG
B sequence
AAGATGGAGAACTCGGCGAGTTTG
AB sequence
GCTCGAACCACTCTCTCAAACTCGCCGAGT
Marker sequence
TGATACTACCAATTTTGTCGGTGTCAACCCGCTCGAACCACTCTCTCAAA
CTCGCCGAGTTCTCCATCTTCTCTTCTAACCCTCAACACAATGAATGAAA
AATTTTCAACTTTTTTTGTAAAGAAGACTTAGAGCTATCACATATTATTA
TAATATTTTTTCTTTTTATCTAAAATTGAAATTAAATATATAAGAAGTTA
TGTTTTATAGTTTTTACGACGAATATTTGATTGTTATTCTAAAAACATGT
TATTTTTATAAAAATTCATTTTACGGAAAAATTTGAAAAAAATAATAACA
GTGAAAGTGCAAAAAAGAAACGGAATATAAGTTCTTGAATGATTTCTCAA
ATTTCAGTATAACTTGGAGTTGTATTCAGTTTTTGTTTGGCCAAAAATTA
ATTTTCAAATATAATAAAAATATTTGAAAAAATTATAATAGATCAAACGA
GTCTTTAGACTTTAAGTGTTCTAATTTAACATTTAAGTTTATTTT
Genomic location of TG27  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D179 marker 179
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)