SGN Marker solcap_snp_sl_100338

SGN-M17901

Synonyms  
CL015959-0346
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54232)
Chromosome
1
Position
66.64 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGAGCCAGTTAAGAAAGCTGCNAGTGATCCTTACACCAAAGACGCTCTCCTTGCTTGTGAAGAGGTGTTTGATCTAGCCGTTGAGGAACTAAGGGGCTCT
  
3' flanking region
TCGCTAGGATTGAGAACTTTGATTTCTCNAAGATGAAGGATATAGTGGATGACCTCAAGTCATGGCTTAGCGCTGTCGTTGCTTATGAAGAGACTTGTTT
SNP nucleotide
AG
SNPdb format
TGAGCCAGTTAAGAAAGCTGCNAGTGATCCTTACACCAAAGACGCTCTCCTTGCTTGTGAAGAGGTGTTTGATCTAGCCGTTGAGGAACTAAGGGGCTCT[A/G]
TCGCTAGGATTGAGAACTTTGATTTCTCNAAGATGAAGGATATAGTGGATGACCTCAAGTCATGGCTTAGCGCTGTCGTTGCTTATGAAGAGACTTGTTT
  
Genomic location of solcap_snp_sl_100338  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17901 marker 17901
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)