SGN Marker T1143

SGN-M1792
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TFBBG32TH
Arabidopsis best BAC match: AC001645.1
Arabidopsis position: 3.0370000
Arabidopsis identities: 0.564
Best GenBank protein hit: BAB01276.1
Evalue: 1.1e-70
Identities: 0.652
Description: proline-rich protein APG-like; GDSL-motif [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49396)
Chromosome
3
Position
63.41 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47331)
Chromosome
3
Position
124.13 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39518)
Chromosome
3
Position
159.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1143 was used as an overgo probe on plate 2 [well H8]

Plausible BAC Matches:   P161H19,   P158L12,   P293L14,   P280H02,   P166B19,   P178I09

 Non-Plausible BAC matches

P221O11,   P327B08,   P207K20,   P021L13,   P079K08,   P266A19,   P004D04

 Overgo Sequences

A sequence
GTTGTTGGTGGCGTTATTGGGTTC
B sequence
ACTCAAACGGATCGCAGAACCCAA
AB sequence
GTTGTTGGTGGCGTTATTGGGTTCTGCGAT
Marker sequence
GGAGAATGGGCATCTACAATAATAGACCAGCATTGTTATTGTTGTTGGTG
GCGTTATTGGGTTCTGCGATCCGTTTGAGTAGTGCTCAAGAATCAACAAC
GCTTGTTCCAGCAATTATTACGTTTGGGGATTCAGCTTCTGATGTAGGAA
ATAATGACTACATTATTACTCTTTTTAAGGCTAATTATCCACCTTATGGA
AGGGATTTTGTAACTCATCAACCTACTGGTAGATTCTGTAATGGCAAATT
AGTAACTGATATGACTGCTGATGCACTTGGCTTCACTACTTACCCGGCTG
CGTATTTGAGCCCTGAAGCATCAGGAAAGAATCTCCTTATTGGTACTAAT
TTCGCTTCTGCCGCTGCTGGCTATGATGATAAAACAGCCATCCTCAACCA
TGCAATTCCATTGTCTAAACAAATGCAATATTATAAGGAGTACAAATCCA
AGCTAGTAAAAGTTGCTGGCAGCCAAAAAGCGGAATCCATCCTAAAGGAT
GCACTCTACATATTAAGTGCTGGAACAGCTGATTTCTTACAGAATTACTA
CTTCAATCCTTATCTTAACAAAATTTCTACTCCTCGTCAGTATAGTTCTT
ATCTTGTTCGCATATTCACTCACTATGTCAAAGATTTGTATGGGCAA
Genomic location of T1143  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1792 marker 1792
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)