SGN Marker solcap_snp_sl_100360

SGN-M17920

Synonyms  
CL016065-0368
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54251)
Chromosome
4
Position
54.25 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATGGCTCAGTAGTGCTACTAGACATGTTNGAATATATGCAGCTTATATTGATCCNGAAACCTTTGCTTTCGATCAAACACAAATGGATAAACTCACACT
  
3' flanking region
CTTCTTGACCCTACTGATGAATTTGTGTGGACTGATGATACTTGTACCAAAGTCTATTCTTACTTCCAAGAACTTGTTGATCATTATGAGGTAATGAAAA
SNP nucleotide
TC
SNPdb format
AATGGCTCAGTAGTGCTACTAGACATGTTNGAATATATGCAGCTTATATTGATCCNGAAACCTTTGCTTTCGATCAAACACAAATGGATAAACTCACACT[T/C]
CTTCTTGACCCTACTGATGAATTTGTGTGGACTGATGATACTTGTACCAAAGTCTATTCTTACTTCCAAGAACTTGTTGATCATTATGAGGTAATGAAAA
  
Genomic location of solcap_snp_sl_100360  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17920 marker 17920
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)