SGN Marker solcap_snp_sl_100381

SGN-M17939

Synonyms  
CL016179-0240
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54270)
Chromosome
11
Position
35.29 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AACAGGTTTTGAAGATATNTAGAAGTCTTCTTCTTATTTAAACCCTGGGAACCTAGCAGAGAACTTGTTTGAGAACTTGGGGCCGGCTTTATGAATCTTC
  
3' flanking region
GTGATCATGTTACTCCTATAAACTAAATAGAATAACAACTAGATTGANTTTTGTAAAGGTTTAATATTTTCCACTTACAGTGTAAGATACATTTAGCTGT
SNP nucleotide
AG
SNPdb format
AACAGGTTTTGAAGATATNTAGAAGTCTTCTTCTTATTTAAACCCTGGGAACCTAGCAGAGAACTTGTTTGAGAACTTGGGGCCGGCTTTATGAATCTTC[A/G]
GTGATCATGTTACTCCTATAAACTAAATAGAATAACAACTAGATTGANTTTTGTAAAGGTTTAATATTTTCCACTTACAGTGTAAGATACATTTAGCTGT
  
Genomic location of solcap_snp_sl_100381  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17939 marker 17939
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)