SGN Marker T1152

SGN-M1798
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBBH50TH
Arabidopsis best BAC match: AC011436.5
Arabidopsis position: 3.0131000
Arabidopsis identities: 0.607
Best GenBank protein hit: AAF14019.1
Evalue: 3.8e-40
Identities: 0.471
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39521)
Chromosome
1
Position
46.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1152 was used as an overgo probe on plate 10 [well B3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CAGTTGATAGGACCAGGTTAGCTC
B sequence
CCATTGAAGGCCTTGAGAGCTAAC
AB sequence
CAGTTGATAGGACCAGGTTAGCTCTCAAGG
Marker sequence
GCAGTTGATAGGACCAGGTTAGCTCTCAAGGCCTTCAATGGTCAGAAAAG
ACGATTTTTCCCCCACCTTGATACCAATTATGGTGGGGAGGGTGTGACAA
AGAAACTTCGTGGTCCTCCATCAAGTGATCAACAAGAAACTTGTGAACTG
AAATCAGTGTCTGAAGTTTTGACACATCTGAAAAAGGAGGTCTCAAATGT
AATAACATTCTCTTACCGGCGTTTGGATTGGTTGTTGCGAGCTACCTCAT
TGCCCTCTTCGACCAGTGAAAATTCTATTGAATTATCAAAAGAGAGTACT
TTCCAAAGCACGAGAACATTAAGACAAGGATCATCTGATGATGATGTTTC
AGACAAGGTTGCTATAATCGAATTGTTGATTCCTTCTGTTTTTAGAGCCA
TAGCATCAGTTTCCCCTGCTGGTTCCTTGGATCCCGACGCTGTAGCATTC
TTCTCGCCAAACGAGGGTGGTAGCTACATTCATGCGAGGGGATTCTCCGT
TCATCATGTATTTAGGCACATCACGGAGCATGCTGCTATGGCTTTACAGC
ATTTTACAGGTGTTGGTACTGAGTCACCCTTGCTTTCTTTGCTGGCTGGG
Genomic location of T1152  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1798 marker 1798
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)